Tlr5 Ecd Invivogen

Lab Reagents

Human IgG antibody Laboratories manufactures the tlr5 ecd invivogen reagents distributed by Genprice. The Tlr5 Ecd Invivogen reagent is RUO (Research Use Only) to test human serum or cell culture lab samples. To purchase these products, for the MSDS, Data Sheet, protocol, storage conditions/temperature or for the concentration, please contact InVivoGen. Other Tlr5 products are available in stock. Specificity: Tlr5 Category: Ecd Group: Invivogen

Invivogen information

ECD Antibody

1-CSB-PA007370GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against ECD. Recognizes ECD from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB

ECD Antibody

1-CSB-PA007370LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ECD. Recognizes ECD from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:2000

anti-ECD

YF-PA27502 50 ug
EUR 363
Description: Mouse polyclonal to ECD

ECD Conjugated Antibody

C47313 100ul
EUR 397

ECD cloning plasmid

CSB-CL007370HU-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1935
  • Sequence: atggaagaaaccatgaagcttgctacgatggaagacacagtggagtactgcctgttcctgataccagatgagtcaagggactcagataaacataaagagattcttcagaagtacattgagagaataatcactcggtttgcacctatgctggtcccctacatctggcagaatcagc
  • Show more
Description: A cloning plasmid for the ECD gene.

anti- ECD antibody

FNab02619 100µg
EUR 548.75
  • Immunogen: ecdysoneless homolog(Drosophila)
  • Uniprot ID: O95905
  • Gene ID: 11319
  • Research Area: Metabolism
Description: Antibody raised against ECD

ECD Polyclonal Antibody

A58886 100 µg
EUR 570.55
Description: Ask the seller for details

ECD Blocking Peptide

DF12968-BP 1mg
EUR 195

Anti-ECD antibody

PAab02619 100 ug
EUR 386

TLR5 Antibody

AF7634 200ul
EUR 376
Description: TLR5 Antibody detects endogenous levels of TLR5.

TLR5 siRNA

20-abx936897
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

TLR5 siRNA

20-abx936898
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

TLR5 antibody

70R-20850 50 ul
EUR 435
Description: Rabbit polyclonal TLR5 antibody

TLR5 antibody

70R-5979 50 ug
EUR 467
Description: Rabbit polyclonal TLR5 antibody raised against the N terminal of TLR5

TLR5 Antibody

ABD6575 100 ug
EUR 438

TLR5 Antibody

35397-100ul 100ul
EUR 390

TLR5 Antibody

3555R-100
EUR 316