Tlr5 Ecd Invivogen

Lab Reagents

Human IgG antibody Laboratories manufactures the tlr5 ecd invivogen reagents distributed by Genprice. The Tlr5 Ecd Invivogen reagent is RUO (Research Use Only) to test human serum or cell culture lab samples. To purchase these products, for the MSDS, Data Sheet, protocol, storage conditions/temperature or for the concentration, please contact InVivoGen. Other Tlr5 products are available in stock. Specificity: Tlr5 Category: Ecd Group: Invivogen

Invivogen information

ECD siRNA

20-abx914899
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ECD siRNA

20-abx914900
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-ECD

YF-PA27502 50 ug
EUR 363
Description: Mouse polyclonal to ECD

ECD Blocking Peptide

DF12968-BP 1mg
EUR 195

ECD Conjugated Antibody

C47313 100ul
EUR 397

ECD cloning plasmid

CSB-CL007370HU-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1935
  • Sequence: atggaagaaaccatgaagcttgctacgatggaagacacagtggagtactgcctgttcctgataccagatgagtcaagggactcagataaacataaagagattcttcagaagtacattgagagaataatcactcggtttgcacctatgctggtcccctacatctggcagaatcagc
  • Show more
Description: A cloning plasmid for the ECD gene.

ECD Polyclonal Antibody

A58886 100 µg
EUR 570.55
Description: Ask the seller for details

anti- ECD antibody

FNab02619 100µg
EUR 548.75
  • Immunogen: ecdysoneless homolog(Drosophila)
  • Uniprot ID: O95905
  • Gene ID: 11319
  • Research Area: Metabolism
Description: Antibody raised against ECD

Anti-ECD antibody

PAab02619 100 ug
EUR 386

TLR5 Antibody

24365-100ul 100ul
EUR 390

TLR5 Antibody

24366-100ul 100ul
EUR 390

TLR5 antibody

20R-1640 100 ug
EUR 673
Description: Rabbit polyclonal TLR5 antibody

TLR5 antibody

70R-11906 100 ug
EUR 403
Description: Rabbit polyclonal TLR5 antibody

TLR5 antibody

70R-20850 50 ul
EUR 435
Description: Rabbit polyclonal TLR5 antibody

TLR5 Antibody

35397-100ul 100ul
EUR 390

TLR5 Antibody

3555R-100
EUR 316

TLR5 Antibody

3555R-30T
EUR 146